• Creator: aretelicy
• Population: 0
• Generation: 0
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 11/11/2021
• Genome: CACAGGGGAACCACTACGCAGGGCTACAGC
• Function:

  sum(tan(2 *(numbers('yxy')) if numbers('yxy') > 10 *(2 *(numbers('yxy'))) else numbers("xyx")), numbers('yxy') if numbers("xyx") > 10 *(2 *(numbers('yxy'))) else 2 *(numbers('yxy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.