header

genetic-algorithms.com

 

Inspect aretelicy_0_0_22

Parents

aretelicy_0_0_22 has no parents. It was generated at random.

aretelicy_0_0_22

Image 01

  • Creator: aretelicy
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 11/11/2021
  • Genome: GTCCCCATGTAATCCCGGAAAGGTTAGATA
  • Function:

    numbers("xyx") if numbers("xxx") > numbers('yxr') else numbers('ryy') if product(sqrt(numbers("xxx") if numbers('yxr') > numbers('ryy') else numbers("xyx") if numbers("xxx") > numbers('yxr') else numbers('ryy')), numbers("xxx") if numbers('ryy') > numbers('yxr') else numbers("xxx") if numbers('ryy') > numbers("xyx") else numbers('yxr')) > sqrt(numbers("xxx") if numbers('yxr') > numbers("xyx") if numbers("xxx") > numbers('yxr') else numbers('ryy') else numbers('ryy')) else numbers("xxx") if numbers('yxr') > numbers("xyx") else numbers('ryy') if numbers("xxx") > numbers('yxr') else numbers('ryy')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

aretelicy_0_1_4

Image 01

Genome: ATCCCCATGTAATCCCGGAAAGGTTAGATA

aretelicy_0_1_11

Image 01

Genome: GCCCTCACCAGCGCGCTCCTGGCCCGCATTACC

aretelicy_0_1_6

Image 01

Genome: TAAAACATGTAATCACGCGGATACTTCGAC