• Creator: guest4861
• Population: 1
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 11/12/2021
• Genome: AGGACGGGTGCGACGAAAACCGTGGTTGGC
• Function:

  tan(100 *(numbers('yyx') if numbers("xxx") > 100 *(numbers("xxx")) else numbers('epe') if numbers('yyx') > numbers("xxx") else 100 *(numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.