header

genetic-algorithms.com

 

Inspect guest4861_1_0_8

Parents

guest4861_1_0_8 has no parents. It was generated at random.

guest4861_1_0_8

Image 01

  • Creator: guest4861
  • Population: 1
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 11/12/2021
  • Genome: GTGAACTTATGTTCCGTACGTCCCTTTCGT
  • Function:

    numbers('yyx') if numbers('ryy') > numbers('rrr') if numbers('yyx') > numbers("per") else numbers('ryy') else numbers("per") if numbers('ryy') if numbers('yyx') > numbers('rrr') else numbers("per") > numbers('ryy') else numbers("per") if numbers('ryy') if numbers('yyx') > numbers("per") else numbers('rrr') if numbers('yyx') > numbers("per") else numbers('ryy') > numbers('rrr') if numbers('yyx') > numbers('ryy') else numbers("per") else square(numbers('ryy') if numbers('yyx') if numbers('ryy') > numbers('rrr') else numbers("per") > numbers("per") if numbers("per") if numbers('yyx') > numbers('rrr') else numbers('ryy') > numbers('ryy') else numbers('yyx') else numbers("per"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest4861_1_1_23

Image 01

Genome: GCTGTGAGCTTATGTTCCGTCCGTGCTAGTCGT

guest4861_1_1_7

Image 01

Genome: GTATCTCTGGCCCCCAAAAAATCAGCTGGT