• Creator: guest79
• Population: 0
• Generation: 21
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: CACCGTCGACTTCTTGTCGAGGCTGTTGGA
• Function:

  sum(log(mod(round(round(numbers('rep'), numbers("xyx")), numbers('rep')), round(numbers('rep'), numbers("xyx"))), round(round(numbers('rep'), numbers("xyx")), numbers('rep'))), mod(round(round(numbers('rep'), numbers("xyx")), numbers('rep')), round(numbers('rep'), numbers("xyx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.