header

genetic-algorithms.com

 

Inspect prsmrdn1551_0_0_3

Parents

prsmrdn1551_0_0_3 has no parents. It was generated at random.

prsmrdn1551_0_0_3

Image 01

  • Creator: prsmrdn1551
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/03/2021
  • Genome: CCTACACGAAATGTCTGTAAAGGTGCTGAG
  • Function:

    divide(gradient[2](mod(noise(numbers('xyy') if numbers('ryy') > numbers('ryy') else numbers("xxx")), numbers('ryy') if numbers('ryy') > numbers("xxx") else numbers('xyy'))), mod(noise(numbers('xyy') if numbers("xxx") > numbers('ryy') else numbers('ryy')), numbers('xyy') if numbers('ryy') > numbers('ryy') else numbers("xxx")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

prsmrdn1551_0_1_15

Image 01

Genome: GCTCAAGTTTATGCACAGTAAGGGCTGCAC