header

genetic-algorithms.com

 

Inspect prsmrdn1551_0_0_9

Parents

prsmrdn1551_0_0_9 has no parents. It was generated at random.

prsmrdn1551_0_0_9

Image 01

  • Creator: prsmrdn1551
  • Population: 0
  • Generation: 0
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 12/03/2021
  • Genome: TTGACCCGACCAGCCACATTAATAGAAATA
  • Function:

    10 *(mod(product(numbers("yyy") if numbers("per") > numbers("per") else numbers("xxx"), numbers("yyy")), numbers("yyy") if numbers("xxx") > numbers("per") else numbers("per"))) if product(numbers("per") if numbers("per") > numbers("yyy") else numbers("xxx"), numbers("yyy")) > numbers("xxx") if numbers("per") > numbers("per") else numbers("yyy") else mod(product(numbers("yyy") if numbers("xxx") > numbers("per") else numbers("per"), numbers("yyy")), numbers("yyy") if numbers("per") > numbers("xxx") else numbers("per"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

prsmrdn1551_0_1_17

Image 01

Genome: GTCTTGACCGGACCAGCCACATTATCCTTAATA

prsmrdn1551_0_1_11

Image 01

Genome: CCCTTGACCCGACCAGCCAGGCGAACAGATATA

prsmrdn1551_0_1_8

Image 01

Genome: TAGACCCGACCAGCCACATTAATAGACACA