• Creator: prsmrdn1551
• Population: 0
• Generation: 0
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 12/03/2021
• Genome: GGGGGACTAACGCTTACTCTACCCCTAGAG
• Function:

  100 *(round(numbers('xyy'), numbers("per"))) if round(numbers('xyy'), numbers("per")) > max(100 *(round(numbers('xyy'), numbers("per"))), round(numbers('xyy'), numbers("per"))) if round(numbers('xyy'), numbers("per")) > numbers('xyy') else 100 *(round(numbers('xyy'), numbers("per"))) else max(100 *(round(numbers('xyy'), numbers("per"))), round(numbers('xyy'), numbers("per")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.