• Creator: prsmrdn1551
• Population: 0
• Generation: 0
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 12/03/2021
• Genome: GGGGGACTAACGCTTACTCTACCCCTAGAG
• Function:

  max(100 *(round(numbers('xyy'), numbers("per"))), round(numbers('xyy'), numbers("per"))) if 100 *(round(numbers('xyy'), numbers("per"))) > numbers('xyy') else round(numbers('xyy'), numbers("per")) if 100 *(round(numbers('xyy'), numbers("per"))) > round(numbers('xyy'), numbers("per")) else max(100 *(round(numbers('xyy'), numbers("per"))), round(numbers('xyy'), numbers("per")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.