• Creator: guest79
• Population: 0
• Generation: 22
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: CAGAGTATGCACCAGGCGCTCCTGCTGCCT
• Function:

  minus(gradient[1](sqrt(sum(minus(numbers('yxy'), numbers('rep')), numbers('yxy')))), sqrt(sum(minus(numbers('yxy'), numbers('rep')), numbers('yxy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.