• Creator: guest145
• Population: 0
• Generation: 0
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: ACAACACCCAACCGCTACGTTTCAATGATC
• Function:

  gradient[2](gradient[2](product(square(round(numbers("xxy"), numbers('rrr'))), round(numbers("xxy"), numbers('rrr')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.