• Creator: guest145
• Population: 0
• Generation: 1
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: AGAACGCCCACCAATATAGAACAATCTGCATAC
• Function:

  sin(100 *(product(10 *(noise(logn(numbers("xxx")))), noise(logn(numbers("xxx"))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.