header

genetic-algorithms.com

 

Inspect guest145_0_2_11

Parents

Mother

Image 01

guest145_0_1_27

Genome: AGACACGCGATAAGCAATTGCAGGTATCCA

Father

Image 01

guest145_0_1_27

Genome: AGACACGCGATAAGCAATTGCAGGTATCCA

guest145_0_2_11

Image 01

  • Creator: guest145
  • Population: 0
  • Generation: 2
  • Total Fitness: 4
  • No. Votes: 1
  • Avg. Fitness 4
  • Created: 05/19/2019
  • Genome: AGACACGCGATAAGCTATTGCAGGTATCCA
  • Function:

    sin(sum(logn(cos(numbers("yxx"))) if numbers('xry') > cos(numbers("yxx")) else numbers("yxx"), logn(cos(numbers("yxx")))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest145_0_2_11 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!