• Creator: guest145
• Population: 0
• Generation: 2
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: TAGACCCCTAGAAGGCTACACGACGAACCT
• Function:

  divide(sin(tan(numbers("per"))), tan(numbers("per"))) if sin(tan(numbers("per"))) > tan(numbers("per")) else 10 *(divide(sin(tan(numbers("per"))), tan(numbers("per"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.