• Creator: camrobjones
• Population: 8
• Generation: 0
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: TGGAGTAGGACCAGTCCTATGCTCAGTGAT
• Function:

  gradient[1](numbers('xyy')) if gradient[1](tan(10 *(gradient[1](numbers('xyy'))))) > 10 *(gradient[1](numbers('xyy'))) else tan(10 *(gradient[1](numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.