• Creator: camrobjones
• Population: 8
• Generation: 0
• Total Fitness: 18
• No. Votes: 2
• Avg. Fitness 9
• Created: 05/19/2019
• Genome: TGGAGCACCTTAACATGGATGATCGCGATG
• Function:

  numbers('yxr') if numbers('epe') > gradient[2](numbers('yxr')) else numbers('rep') if cos(10 *(numbers('epe') if gradient[2](numbers('yxr')) > numbers('rep') else numbers('yxr'))) > 10 *(gradient[2](numbers('yxr')) if numbers('epe') > numbers('rep') else numbers('yxr')) else gradient[2](numbers('yxr'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.