header

genetic-algorithms.com

 

Inspect guest145_0_5_5

Parents

Mother

Image 01

guest145_0_4_1

Genome: GTAAGCCACATCAGCATGGCTAAGGAAATC

Father

Image 01

guest145_0_4_21

Genome: CCAGTACGGCCCGATTCGCGAATGTTATTGTTG

guest145_0_5_5

Image 01

  • Creator: guest145
  • Population: 0
  • Generation: 5
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/19/2019
  • Genome: GTAGGACACATCAGCATGGCTAAGGAAATC
  • Function:

    sum(band pass(cos(numbers('epe'))), cos(numbers('epe'))) if band pass(cos(numbers('epe'))) if sum(band pass(cos(numbers('epe'))), cos(numbers('epe'))) > numbers('epe') else cos(numbers('epe')) > cos(numbers('epe')) else band pass(cos(numbers('epe')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest145_0_5_5 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!