header

genetic-algorithms.com

 

Inspect guest145_0_5_15

Parents

Mother

Image 01

guest145_0_4_15

Genome: CCATACAAGATTAACCATAGGACCCCTACA

Father

Image 01

guest145_0_4_23

Genome: GGTTCGGCTCCTCCCGGCGACTTCTATACATCG

guest145_0_5_15

Image 01

  • Creator: guest145
  • Population: 0
  • Generation: 5
  • Total Fitness: 3
  • No. Votes: 1
  • Avg. Fitness 3
  • Created: 05/19/2019
  • Genome: CCATACAAGATTAACCATAGAACCCCTACA
  • Function:

    product(square(numbers("yxx")) if numbers("yxx") > invert(gradient[0](square(numbers("yxx")))) else gradient[0](square(numbers("yxx"))), invert(gradient[0](square(numbers("yxx")))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest145_0_6_25

Image 01

Genome: GTGCCATACAAGATTAACCACGCATTTGACTTA