• Creator: guest145
• Population: 0
• Generation: 5
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: CATTACAAGACTCCCGACGACCATTACAAA
• Function:

  minus(product(numbers("xxy"), numbers("xxy")) if numbers("xxy") > 2 *(product(numbers("xxy"), numbers("xxy"))) else invert(2 *(product(numbers("xxy"), numbers("xxy")))), invert(2 *(product(numbers("xxy"), numbers("xxy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.