• Creator: guest5441
• Population: 0
• Generation: 0
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 04/08/2022
• Genome: ACGAGTTGCCGTAGTTCTCTCACCATCTAT
• Function:

  100 *(gradient[1](numbers('xyy') if gradient[1](numbers('xyy')) > numbers('rep') else log(gradient[1](numbers('xyy')), numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.