• Creator: guest5441
• Population: 0
• Generation: 1
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 04/08/2022
• Genome: ATTATAAGCCTTCATATATGTAATATACAAGCG
• Function:

  gradient[0](logn(cos(round(minus(logn(numbers('ryy')), numbers('ryy')), logn(numbers('ryy'))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.