header

genetic-algorithms.com

 

Inspect guest5441_0_2_0

Parents

Mother

Image 01

guest5441_0_1_22

Genome: TCGGGCTTATTATCCTCCCGCCGAGCCTGT

Father

Image 01

guest5441_0_1_16

Genome: TATCCAATCGTTGGCCACGCCAGCCTCGAA

guest5441_0_2_0

Image 01

  • Creator: guest5441
  • Population: 0
  • Generation: 2
  • Total Fitness: 9
  • No. Votes: 1
  • Avg. Fitness 9
  • Created: 04/08/2022
  • Genome: GTTTCGGGCTTGTTATCCTCCCTCAGCCCCTGA
  • Function:

    numbers('rep') if numbers('yyx') > numbers('xry') if numbers('yyx') > numbers('rep') else numbers('yyx') else numbers('xry') if numbers('yyx') if numbers('yyx') if numbers('rep') > numbers('xry') else numbers('yyx') if numbers('xry') > numbers('yyx') else numbers('rep') if numbers('yyx') > numbers('rep') else numbers('xry') if numbers('yyx') > numbers('rep') else numbers('yyx') > numbers('yyx') if numbers('rep') > numbers('xry') else numbers('yyx') else numbers('rep') if numbers('yyx') > numbers('yyx') else numbers('xry') if numbers('rep') > numbers('yyx') else numbers('xry') > numbers('xry') if numbers('yyx') if numbers('xry') > numbers('rep') else numbers('yyx') > numbers('rep') else numbers('yyx') if numbers('yyx') if numbers('xry') > numbers('rep') else numbers('yyx') > numbers('yyx') else numbers('rep') else numbers('yyx') if numbers('xry') if numbers('yyx') > numbers('yyx') else numbers('rep') > numbers('rep') if numbers('xry') if numbers('yyx') > numbers('rep') else numbers('yyx') > numbers('yyx') else numbers('xry') if numbers('yyx') if numbers('xry') > numbers('yyx') else numbers('rep') > numbers('yyx') else numbers('rep') else numbers('xry') if numbers('rep') > numbers('yyx') else numbers('yyx') if numbers('yyx') > numbers('rep') else numbers('xry') if numbers('xry') if numbers('rep') > numbers('rep') if numbers('yyx') > numbers('yyx') else numbers('xry') else numbers('yyx') if numbers('rep') > numbers('yyx') if numbers('yyx') > numbers('xry') else numbers('rep') else numbers('yyx') > numbers('rep') if numbers('yyx') > numbers('xry') else numbers('yyx') if numbers('xry') > numbers('yyx') else numbers('rep') else numbers('yyx') if numbers('xry') > numbers('yyx') else numbers('rep')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest5441_0_3_8

Image 01

Genome: GTTTCGGGCTTGTTATACTCCCTCAGCCGGGGA

guest5441_0_3_23

Image 01

Genome: TCGGGCTTTTCCTCTCCACGCCTCAGCTCT

guest5441_0_3_21

Image 01

Genome: ACTATAACCCGCTTGTTCCACCGATCCCAAGAG

guest5441_0_3_7

Image 01

Genome: ATAAGCCTTTAAATCCACCGATCCCCAGCG