header

genetic-algorithms.com

 

Inspect guest5441_0_2_20

Parents

Mother

Image 01

guest5441_0_1_27

Genome: GTCAATGTGTGACGGCAATACGCTTAGAAG

Father

Image 01

guest5441_0_1_17

Genome: TTTCCTGATAGCAACCGTAGGATACGCGGT

guest5441_0_2_20

Image 01

  • Creator: guest5441
  • Population: 0
  • Generation: 2
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 04/08/2022
  • Genome: TTCCGCAACGTGTGACGGCACTACGCTTAGAAG
  • Function:

    numbers("xxy") if exp(numbers("xxy"), numbers("xxy")) > numbers("xxy") else numbers('xyy') if round(square(numbers("xxy") if numbers("xxy") > numbers('xyy') else exp(numbers("xxy"), numbers("xxy")) if numbers("xxy") > exp(numbers("xxy"), numbers("xxy")) else numbers("xxy")), numbers("xxy") if numbers("xxy") if numbers('xyy') > numbers("xxy") else exp(numbers("xxy"), numbers("xxy")) > exp(numbers("xxy"), numbers("xxy")) else numbers("xxy")) > square(numbers('xyy') if numbers("xxy") > exp(numbers("xxy"), numbers("xxy")) else numbers("xxy") if numbers("xxy") > exp(numbers("xxy"), numbers("xxy")) else numbers("xxy")) else exp(numbers("xxy"), numbers("xxy")) if numbers("xxy") > numbers('xyy') else numbers("xxy") if numbers("xxy") > numbers("xxy") else exp(numbers("xxy"), numbers("xxy"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest5441_0_3_22

Image 01

Genome: TTCCGGTCACAAGGATAGTCCCGCGCTTAGAAG

guest5441_0_3_2

Image 01

Genome: CGTTTCCGCAACGTGTCAAGAAACTACGATTAGAAG

guest5441_0_3_11

Image 01

Genome: CAATACCGCAACGTGTTCTACCGATCCCAAGCG