• Creator: guest145
• Population: 0
• Generation: 8
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: CTTAATCTACGGCCCAATAACCTAATTTAG
• Function:

  round(noise(max(exp(product(numbers("yxx"), numbers("xxy")), numbers("yxx")), product(numbers("yxx"), numbers("xxy")))), max(exp(product(numbers("yxx"), numbers("xxy")), numbers("yxx")), product(numbers("yxx"), numbers("xxy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.