header

genetic-algorithms.com

 

Inspect global_global_0_0_87

Parents

global_global_0_0_87 has no parents. It was generated at random.

global_global_0_0_87

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 22
  • No. Votes: 4
  • Avg. Fitness 5.5
  • Created: 05/19/2019
  • Genome: ACACTAGTTGAGTGCCCTGACGAGGTGACA
  • Function:

    gradient[2](max(numbers("xxy") if numbers('xyy') > numbers("xxy") if numbers('epe') > numbers('xyy') else numbers("xyx") else numbers('xyy') if numbers("xyx") > numbers("xxy") else numbers('epe') if numbers("xxy") > numbers('xyy') else numbers("xyx"), numbers("xxy") if numbers('xyy') > numbers('epe') if numbers('xyy') > numbers("xyx") else numbers("xxy") else numbers("xyx")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest195_0_1_323

Image 01

Genome: GGATATAATGGGTGCCCTGACGAGGTGACA

guest75_0_1_258

Image 01

Genome: GTAACATTAGTTGAGTCCCCCATTTCGGTTACA

sina12345_0_1_206

Image 01

Genome: AGTACACTATTTGAGTCTTTATCTTAGCTGACA

guest30_0_1_49

Image 01

Genome: ACTCTAGTTGCGTGCCCTGACGAGGTGACA

guest200_0_1_336

Image 01

Genome: GCTAGTGGCTTGTCCAAGGGGCGCACACTT

sina12345_0_1_136

Image 01

Genome: TGCTAGGCATACATGTGCCCTGGCGTTTACGAC

guest30_0_1_50

Image 01

Genome: ATACAAGTTGAGTGCCCTGGCGAGGTCACG