header

genetic-algorithms.com

 

Inspect global_global_0_0_88

Parents

global_global_0_0_88 has no parents. It was generated at random.

global_global_0_0_88

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 53
  • No. Votes: 7
  • Avg. Fitness 7.6
  • Created: 05/19/2019
  • Genome: GTATGATCTAATCTATAAACAGATCTTGTA
  • Function:

    noise(max(numbers("xxx"), numbers("yyy"))) if noise(max(numbers("xxx"), numbers("yyy"))) if numbers("yyy") > numbers("xxx") else max(numbers("xxx"), numbers("yyy")) > max(numbers("xxx"), numbers("yyy")) else max(numbers("xxx"), numbers("yyy")) if max(numbers("xxx"), numbers("yyy")) if numbers("xxx") > numbers("yyy") else noise(max(numbers("xxx"), numbers("yyy"))) > numbers("xxx") else noise(max(numbers("xxx"), numbers("yyy")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest195_0_1_304

Image 01

Genome: CGAGGATGATCTAATCTGTAAACAGATCTTGTA

sina12345_0_1_244

Image 01

Genome: TACGTATGACCTAATCTCTAAACAGATGTTGTT

sina12345_0_1_187

Image 01

Genome: CGAGTATGATCTAATCTACGAACAGATCTTGTA

guest30_0_1_57

Image 01

Genome: GAATGATGCGTTAACAGAAGGGATCTTGTA

sina12345_0_1_156

Image 01

Genome: CCATTAGCACACCTTAGGACTGATGTTGGT

guest52_0_1_119

Image 01

Genome: GGAATCAACACTAATGTACACCGTTGAGATAGC

guest30_0_1_95

Image 01

Genome: GTAGTCTAGTTTTTCACCTTTCCTCATAAT