• Creator: Citrus00
• Population: 0
• Generation: 1
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: AGCTCTACAGTTACTCGGCCTTGGCCAAATTAC
• Function:

  cos(2 *(exp(numbers('xyy'), numbers('yxr'))) if exp(numbers('xyy'), numbers('yxr')) > gradient[2](exp(numbers('xyy'), numbers('yxr')) if numbers('yxr') > 2 *(exp(numbers('xyy'), numbers('yxr'))) else numbers('xyy')) else numbers('yxr') if exp(numbers('xyy'), numbers('yxr')) > numbers('xyy') else 2 *(exp(numbers('xyy'), numbers('yxr'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.