• Creator: guest6151
• Population: 0
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 09/07/2022
• Genome: GGGGGCACCACGCGCCACTGAGGGTTCAGA
• Function:

  100 *(round(numbers("xxy"), numbers("xxr"))) if round(numbers("xxy"), numbers("xxr")) > 10 *(100 *(round(numbers("xxy"), numbers("xxr")))) else round(numbers("xxy"), numbers("xxr")) if numbers("xxy") > 10 *(100 *(round(numbers("xxy"), numbers("xxr")))) else 100 *(round(numbers("xxy"), numbers("xxr")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.