• Creator: guest6177
• Population: 0
• Generation: 1
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 09/14/2022
• Genome: AGCCGGTACACAAAATGCAAGTGCTTTGTC
• Function:

  cos(exp(gradient[2](abs(numbers('xry'))) if numbers('xry') > abs(numbers('xry')) else numbers("xyx"), gradient[2](abs(numbers('xry')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.