• Creator: guest6177
• Population: 0
• Generation: 4
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 09/14/2022
• Genome: CCGGGGAATTGTAGCACGTACCCGGTTTCCCCTTCA
• Function:

  divide(100 *(numbers("xxy")) if numbers("xxy") > numbers('yxy') else cos(100 *(numbers("xxy"))) if cos(100 *(numbers("xxy"))) > 100 *(numbers("xxy")) else noise(cos(100 *(numbers("xxy"))) if 100 *(numbers("xxy")) > numbers("xxy") else numbers('yxy')), noise(100 *(numbers("xxy")) if numbers('yxy') > numbers("xxy") else cos(100 *(numbers("xxy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.