• Creator: guest6177
• Population: 0
• Generation: 4
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 09/14/2022
• Genome: CCGGGGAATTGTAGCACGTACCCGGTTTCCCCTTCA
• Function:

  divide(noise(cos(100 *(numbers("xxy"))) if numbers("xxy") > numbers('yxy') else 100 *(numbers("xxy"))) if 100 *(numbers("xxy")) > cos(100 *(numbers("xxy"))) else numbers("xxy") if 100 *(numbers("xxy")) > cos(100 *(numbers("xxy"))) else numbers('yxy'), noise(numbers("xxy") if numbers('yxy') > cos(100 *(numbers("xxy"))) else 100 *(numbers("xxy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.