header

genetic-algorithms.com

 

Inspect Citrus00_0_5_18

Parents

Mother

Image 01

Citrus00_0_4_4

Genome: CATCCGGGGACACGCTGTATGGAGGTTCGCGGG

Father

Image 01

Citrus00_0_4_4

Genome: CATCCGGGGACACGCTGTATGGAGGTTCGCGGG

Citrus00_0_5_18

Image 01

  • Creator: Citrus00
  • Population: 0
  • Generation: 5
  • Total Fitness: 4
  • No. Votes: 1
  • Avg. Fitness 4
  • Created: 05/19/2019
  • Genome: CCTGATCCGGGGACACGCAGTATGCAGGTTGGCGGG
  • Function:

    divide(divide(numbers('epe') if round(numbers('ryy'), numbers('epe')) > gradient[2](round(numbers('ryy'), numbers('epe'))) else numbers('ryy'), gradient[2](round(numbers('ryy'), numbers('epe')))) if numbers('epe') if gradient[2](round(numbers('ryy'), numbers('epe'))) > numbers('ryy') else round(numbers('ryy'), numbers('epe')) > gradient[2](round(numbers('ryy'), numbers('epe'))) else round(numbers('ryy'), numbers('epe')), divide(numbers('epe') if round(numbers('ryy'), numbers('epe')) > numbers('ryy') else gradient[2](round(numbers('ryy'), numbers('epe'))), gradient[2](round(numbers('ryy'), numbers('epe')))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Citrus00_0_5_18 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!