• Creator: guest6177
• Population: 0
• Generation: 4
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 09/14/2022
• Genome: TTAGAAGAGAGTCGATTGTAAAACACTAAA
• Function:

  mod(numbers('epe'), numbers("xxx")) if mod(numbers('epe'), numbers("xxx")) if numbers('epe') > numbers("xxx") else gradient[1](mod(numbers('epe'), numbers("xxx"))) > numbers('epe') if numbers("xxx") if numbers('epe') > mod(numbers('epe'), numbers("xxx")) else gradient[1](mod(numbers('epe'), numbers("xxx"))) > gradient[1](mod(numbers('epe'), numbers("xxx"))) else mod(numbers('epe'), numbers("xxx")) else gradient[1](mod(numbers('epe'), numbers("xxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.