• Creator: guest6177
• Population: 0
• Generation: 5
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 09/14/2022
• Genome: GACACGAGAAGCCGTCAATATTCGGTTCCCGCT
• Function:

  cos(log(sum(numbers("yxx"), numbers('yxy')), numbers("yxx"))) if log(sum(numbers("yxx"), numbers('yxy')), numbers("yxx")) > sin(cos(log(sum(numbers("yxx"), numbers('yxy')), numbers("yxx")))) else 100 *(sin(cos(log(sum(numbers("yxx"), numbers('yxy')), numbers("yxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.