• Creator: guest6177
• Population: 0
• Generation: 6
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 09/14/2022
• Genome: CTCCGCAGGAGAAGCTGTTATTCGGCCACT
• Function:

  min(round(tan(sin(cos(numbers('ryy')))), sin(cos(numbers('ryy')))), tan(sin(cos(numbers('ryy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.