• Creator: guest6177
• Population: 0
• Generation: 7
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 09/14/2022
• Genome: AAAGCCAGAAGAAGTTACTTTTCCTATCAT
• Function:

  abs(numbers("xxy") if gradient[1](numbers("xxy")) > sin(sin(gradient[1](numbers("xxy")))) else sin(gradient[1](numbers("xxy"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.