header

genetic-algorithms.com

 

Inspect guest6177_0_10_8

Parents

Mother

Image 01

guest6177_0_9_28

Genome: TCCTACGGTACTAGCGTCCTACTAGCCGTG

Father

Image 01

guest6177_0_9_10

Genome: CTGCCTCGCACCCCCCCCAGCTGGGCCGGAAAT

guest6177_0_10_8

Image 01

  • Creator: guest6177
  • Population: 0
  • Generation: 10
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 09/14/2022
  • Genome: TCCCACGGTACTACCGTCATACTAGCCGTG
  • Function:

    10 *(numbers('rep')) if numbers("per") if 10 *(numbers('rep')) > 2 *(10 *(numbers('rep'))) else numbers('rep') > sum(numbers("per") if 2 *(10 *(numbers('rep'))) > numbers('rep') else 10 *(numbers('rep')), 2 *(10 *(numbers('rep')))) else 2 *(10 *(numbers('rep')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest6177_0_10_8 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!