header

genetic-algorithms.com

 

Inspect guest6177_0_10_24

Parents

Mother

Image 01

guest6177_0_9_1

Genome: CATACCTGACGCAGCGAGGACGACCATGAGGCT

Father

Image 01

guest6177_0_9_10

Genome: CTGCCTCGCACCCCCCCCAGCTGGGCCGGAAAT

guest6177_0_10_24

Image 01

  • Creator: guest6177
  • Population: 0
  • Generation: 10
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 09/14/2022
  • Genome: CTACATACCTGCCGCAGCGAGGACGAGGCCGGGAAT
  • Function:

    max(minus(10 *(numbers("xyx") if cos(numbers("xyx")) > numbers("xxy") else round(cos(numbers("xyx")), numbers("xyx"))), numbers("xxy") if numbers("xyx") > cos(numbers("xyx")) else round(cos(numbers("xyx")), numbers("xyx"))), 10 *(numbers("xyx") if round(cos(numbers("xyx")), numbers("xyx")) > cos(numbers("xyx")) else numbers("xxy")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest6177_0_11_6

Image 01

Genome: CGGCTACATACCTGCCGCCGCGAGGACGAGTCCGGGAAT

guest6177_0_11_20

Image 01

Genome: TTCCTACTACACCCTTTGAGAAGGGACACACCACACCAG