• Creator: guest6177
• Population: 0
• Generation: 11
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 09/14/2022
• Genome: AAACTTACTAGGATATATTCCTTTCCTGCG
• Function:

  abs(round(2 *(tan(logn(numbers("yxx")))), tan(logn(numbers("yxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.