• Creator: guest6177
• Population: 0
• Generation: 14
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 09/14/2022
• Genome: CTGCAAAGCCAACGTGTGTACACAGTCCAC
• Function:

  mean(sum(cos(sum(log(numbers('epe'), numbers("xxy")), numbers('epe'))), sum(log(numbers('epe'), numbers("xxy")), numbers('epe'))), cos(sum(log(numbers('epe'), numbers("xxy")), numbers('epe'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.