header

genetic-algorithms.com

 

Inspect Citrus00_0_6_20

Parents

Mother

Image 01

Citrus00_0_5_29

Genome: ATAATGCCAACCGTCATGAAGTATGTTTGC

Father

Image 01

Citrus00_0_5_9

Genome: CGAGAATGCTTTTATGAAACACAGGCACTCACT

Citrus00_0_6_20

Image 01

  • Creator: Citrus00
  • Population: 0
  • Generation: 6
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/19/2019
  • Genome: ACCATAATGCTGGCCGTCCTGAAATATGTTTGC
  • Function:

    10 *(logn(sqrt(mean(numbers("yxx") if numbers('epe') > numbers("xxx") else numbers("xxx") if numbers("yxx") > numbers('rrr') else numbers('epe'), numbers('epe') if numbers("yxx") > numbers('rrr') else numbers("xxx")))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

Citrus00_0_6_20 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!