• Creator: Citrus00
• Population: 0
• Generation: 6
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: AAGTGGCTACTCCTGACGTAAAGCAATAGTTACCTA
• Function:

  invert(mean(100 *(numbers("xxx")), numbers("xxx")) if min(mean(100 *(numbers("xxx")), numbers("xxx")), 100 *(numbers("xxx"))) > 100 *(numbers("xxx")) else max(min(mean(100 *(numbers("xxx")), numbers("xxx")), 100 *(numbers("xxx"))), mean(100 *(numbers("xxx")), numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.