• Creator: guest164
• Population: 0
• Generation: 1
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: CGATAGTCAACCAATCCGTAAAATCCTGAC
• Function:

  mod(numbers('yxy') if 10 *(noise(numbers('yxy'))) if numbers("xxx") > noise(numbers('yxy')) else numbers('yxy') > noise(numbers('yxy')) else 10 *(noise(numbers('yxy'))), numbers('yxy') if noise(numbers('yxy')) > numbers("xxx") else 10 *(noise(numbers('yxy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.