• Creator: Citrus00
• Population: 0
• Generation: 8
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: CGCCAATTGCCAACCACACATCAAAGATGA
• Function:

  round(sum(numbers("yxx") if numbers("yyy") > 10 *(numbers("yyy")) else product(10 *(numbers("yyy")), numbers("yyy")), product(10 *(numbers("yyy")), numbers("yyy"))), numbers("yyy") if 10 *(numbers("yyy")) > numbers("yxx") else product(10 *(numbers("yyy")), numbers("yyy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.