• Creator: guest165
• Population: 0
• Generation: 0
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 05/19/2019
• Genome: CAGAATATTTTGACGCGAAATGAAGAGGTG
• Function:

  minus(noise(gradient[0](numbers("xxx") if 100 *(numbers("xxr")) > numbers("yxx") else numbers("xxr"))), gradient[0](numbers("yxx") if numbers("xxx") > numbers("xxr") else 100 *(numbers("xxr"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.