• Creator: guest169
• Population: 0
• Generation: 0
• Total Fitness: 1
• No. Votes: 1
• Avg. Fitness 1
• Created: 05/19/2019
• Genome: TGTATCCGCACTCCAAGCGCCCATTACAGT
• Function:

  product(numbers('xry'), numbers('yyx')) if band pass(round(2 *(product(numbers('xry'), numbers('yyx'))), product(numbers('xry'), numbers('yyx')))) > 2 *(product(numbers('xry'), numbers('yyx'))) else round(2 *(product(numbers('xry'), numbers('yyx'))), product(numbers('xry'), numbers('yyx')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.