• Creator: guest169
• Population: 0
• Generation: 0
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: CGAGGGCAGACCCTGCGCAGAGGCCTCTAT
• Function:

  mod(10 *(mean(numbers('xry'), numbers("xxr"))) if numbers('xry') > mean(numbers('xry'), numbers("xxr")) else minus(10 *(mean(numbers('xry'), numbers("xxr"))), mean(numbers('xry'), numbers("xxr"))), minus(10 *(mean(numbers('xry'), numbers("xxr"))), mean(numbers('xry'), numbers("xxr"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.