header

genetic-algorithms.com

 

Inspect guest6709_0_0_25

Parents

guest6709_0_0_25 has no parents. It was generated at random.

guest6709_0_0_25

Image 01

  • Creator: guest6709
  • Population: 0
  • Generation: 0
  • Total Fitness: 8
  • No. Votes: 1
  • Avg. Fitness 8
  • Created: 03/06/2023
  • Genome: CGGGGAGCATGGTAGCGGTCAATAATCGGT
  • Function:

    exp(numbers("yyy") if numbers('yxr') if numbers("yyy") > numbers("per") else numbers("per") if numbers('rep') > numbers('yxr') else numbers("yyy") > numbers('yxr') else numbers("per") if numbers("yyy") > numbers('rep') else numbers('yxr') if numbers('yxr') if numbers("per") > numbers("yyy") else numbers('rep') > numbers('yxr') else numbers("per") if numbers('rep') > numbers('yxr') else numbers("yyy") if numbers('yxr') > numbers("yyy") else numbers("per"), numbers("per") if numbers('yxr') > numbers("yyy") else numbers("yyy") if numbers('rep') > numbers("per") else numbers('yxr') if numbers("yyy") > numbers("yyy") if numbers('yxr') > numbers('rep') else numbers("per") else numbers('yxr'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest6709_0_1_7

Image 01

Genome: CGGGGAGCATGTCAACAAACAATAATCGGT

guest6709_0_1_12

Image 01

Genome: CATCGGGGAACATGGTAGCGGTCAATAATCGGT

guest6709_0_1_2

Image 01

Genome: TCAAGGCGTATCTCCGCAGGCTTAGCAAGT

guest6709_0_1_12

Image 01

Genome: CATCGGGGAACATGGTAGCGGTCAATAATCGGT