header

genetic-algorithms.com

 

Inspect guest6709_0_1_0

Parents

Mother

Image 01

guest6709_0_0_3

Genome: GTGCGAGGATGATCAGTCTGTGCGTTGTAT

Father

Image 01

guest6709_0_0_21

Genome: ATCGGAAACGGGACCGGATCCTGCCCATAC

guest6709_0_1_0

Image 01

  • Creator: guest6709
  • Population: 0
  • Generation: 1
  • Total Fitness: 8
  • No. Votes: 1
  • Avg. Fitness 8
  • Created: 03/06/2023
  • Genome: GTGCGAGGGTGATCCATCTCCTCCTTGTAT
  • Function:

    numbers('yyx') if numbers('epe') > numbers('yyx') else numbers('rep') if numbers('rep') > numbers('yyx') else numbers('yyx') if numbers('rep') if numbers('yyx') > numbers('yyx') else numbers('epe') > numbers('yyx') else numbers('rep') if numbers('yyx') if numbers('rep') > numbers('yyx') else numbers('epe') > mod(numbers('rep') if numbers('yyx') if numbers('yyx') > numbers('epe') else numbers('rep') > numbers('yyx') if numbers('rep') > numbers('yyx') else numbers('rep') if numbers('epe') > numbers('yyx') else numbers('yyx') else numbers('yyx'), numbers('yyx') if numbers('rep') > numbers('yyx') else numbers('yyx') if numbers('yyx') > numbers('rep') else numbers('epe')) else numbers('rep') if numbers('yyx') > numbers('yyx') else numbers('rep') if numbers('yyx') > numbers('yyx') else numbers('epe')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest6709_0_2_6

Image 01

Genome: CTCGTGCGATGGCCTTAGCTAACCTCCTTTTAT

guest6709_0_2_11

Image 01

Genome: GTGCGAGGGTGAACCATCCGGTCCTTCTAT