header

genetic-algorithms.com

 

Inspect guest6709_0_1_11

Parents

Mother

Image 01

guest6709_0_0_23

Genome: CTCGTATTCCTGTCATAACGAACATGGGAG

Father

Image 01

guest6709_0_0_18

Genome: CTGCCGTAAAGGGTGTGACATTTATGCGAG

guest6709_0_1_11

Image 01

  • Creator: guest6709
  • Population: 0
  • Generation: 1
  • Total Fitness: 3
  • No. Votes: 1
  • Avg. Fitness 3
  • Created: 03/06/2023
  • Genome: CTCGTATTCGTTTCATACCGAACATGGTTG
  • Function:

    min(numbers("xxy") if numbers("xxr") if numbers("xxy") > numbers("yyy") else numbers('yxr') > numbers("xxy") if numbers("xxr") > numbers("xxr") if numbers("yyy") > numbers("xxy") else numbers('yxr') else numbers("yyy") else numbers("xxr") if numbers("xxy") if numbers("xxr") > numbers("yyy") else numbers("yyy") if numbers("xxr") > numbers('yxr') else numbers("xxy") > numbers("xxr") if numbers('yxr') > numbers("yyy") else numbers("xxy") else numbers("xxy"), numbers("xxy") if numbers("xxr") if numbers("xxy") > numbers('yxr') else numbers("yyy") > numbers("yyy") else numbers("xxr") if numbers("xxr") if numbers('yxr') > numbers("yyy") else numbers("xxy") > numbers("xxy") else numbers("xxr"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest6709_0_2_8

Image 01

Genome: AGACCTCCTGACCATCCGGACACTCGATAGTTG

guest6709_0_2_12

Image 01

Genome: CTCGTATTCGTTTCATTCCGAATATAGATT

guest6709_0_2_22

Image 01

Genome: GGTCTCGTATACGTTTCATACCGAACATGCTTG

guest6709_0_2_23

Image 01

Genome: CGACTCCCATTCGTTTCATACCGAACATGATTA