header

genetic-algorithms.com

 

Inspect guest6709_0_1_14

Parents

Mother

Image 01

guest6709_0_0_6

Genome: TGAGTGATAATATACAAGCCGTACAACAGG

Father

Image 01

guest6709_0_0_7

Genome: GTGACGGTCACGAGATGATGACAGATTCTA

guest6709_0_1_14

Image 01

  • Creator: guest6709
  • Population: 0
  • Generation: 1
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 03/06/2023
  • Genome: CTGTGAGTGATAATATACAAGGCGTACAACAGT
  • Function:

    mean(logn(logn(numbers("xyx") if numbers("xxy") > numbers('yxy') else numbers("xxy"))) if logn(numbers("xyx") if numbers('yxy') > numbers("xxy") else numbers("xxy")) > logn(numbers("xxy") if numbers('yxy') > numbers("xyx") else numbers("xxy")) if numbers("xyx") > logn(logn(numbers("xxy") if numbers("xyx") > numbers('yxy') else numbers("xxy"))) else numbers("xxy") if numbers('yxy') > numbers("xxy") else numbers("xyx") else numbers('yxy') if numbers("xxy") > numbers("xxy") else numbers("xyx"), numbers("xyx") if logn(logn(numbers("xxy") if numbers("xyx") > numbers("xxy") else numbers('yxy'))) > numbers("xxy") if numbers('yxy') > numbers("xxy") else numbers("xyx") else logn(numbers("xxy") if numbers("xyx") > numbers('yxy') else numbers("xxy")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest6709_0_1_14 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!