• Creator: guest6709
• Population: 0
• Generation: 1
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 03/06/2023
• Genome: GCAAAAATCACCCGGAATGCCGAATGCATACGA
• Function:

  10 *(exp(noise(numbers('yyx')), numbers('yyx'))) if exp(noise(numbers('yyx')), numbers('yyx')) > abs(band pass(10 *(exp(noise(numbers('yyx')), numbers('yyx'))))) else band pass(10 *(exp(noise(numbers('yyx')), numbers('yyx'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.